Tutorial ======== In this tutorial, we will build oligo porbe set for Arabidopsis genome. Using Docker Terminal Version ----------------------------- Install ******* Install Docker_ .. _Docker: https://docs.docker.com/engine/installation/ Download Chorus: .. code-block:: bash $ docker pull forrestzhang/docker-chorus Parameter of Chorus: .. code-block:: bash -g GENOME, --genome GENOME fasta format genome file -i INPUT, --input INPUT fasta format input file -s SAVED, --save SAVED result saved folder -p PRIMER, --primer PRIMER 5' labeled R primer -t THREADS, --threads THREADS threads number or how may cpu you wanna use -l LENGTH, --length LENGTH probe length --homology HOMOLOGY homology, from 50 to 100 -d DTM, --dtm DTM dTm, from 0 to 37 Download Reference Genome file: .. code-block:: bash $ wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas $ docker run -v $PWD:/home/chorus -e CHORUS_USER=$USER -e CHORUS_UID=$UID \ forrestzhang/docker-chorus -i TAIR10_chr_all.fas -g TAIR10_chr_all.fas -t 12 Please wait unit all precess done. There are some logs: .. code-block:: log forrest /home/chorus use local user: forrest Adding group 'forrest' (GID 1000) ... Done. Adding user 'forrest' ... Adding new user 'forrest' (1000) with group 'forrest' ... Creating home directory '/home/forrest' ... Copying files from '/etc/skel' ... /home/chorus exists 2.2.3 ######################################## bwa version: /opt/software/bwa/bwa 0.7.12-r1044 jellyfish version: /opt/software/jellyfish/bin/jellyfish 2.2.3 genome file: TAIR10_chr_all.fas input file: TAIR10_chr_all.fas 5' labeled R primer: result output folder: /home/chorus/probes threads number: 12 homology: 75 dtm: 10 ######################################## ... ... 14300000 / 14326857 14310000 / 14326857 14320000 / 14326857 Job finshed!! When process done: .. code-block:: bash $ ls -lt probes/ total 1741428 -rw-r--r-- 1 root root 280927981 Aug 24 17:44 TAIR10_chr_all.fas_all.bed -rw-r--r-- 1 root root 62050561 Aug 24 17:44 TAIR10_chr_all.fas.bed -rw-r--r-- 1 root root 94 Aug 24 17:30 TAIR10_chr_all.fas.len -rw-r--r-- 1 root root 1031512169 Aug 24 17:22 TAIR10_chr_all.fas_tmp_probe.fa -rw-r--r-- 1 root root 59833928 Aug 24 17:19 TAIR10_chr_all.fas.sa -rw-r--r-- 1 root root 7535 Aug 24 17:18 TAIR10_chr_all.fas.amb -rw-r--r-- 1 root root 682 Aug 24 17:18 TAIR10_chr_all.fas.ann -rw-r--r-- 1 root root 29916939 Aug 24 17:18 TAIR10_chr_all.fas.pac -rw-r--r-- 1 root root 119667836 Aug 24 17:18 TAIR10_chr_all.fas.bwt -rw-r--r-- 1 root root 121183059 Aug 24 17:17 TAIR10_chr_all.fas -rw-r--r-- 1 root root 78102510 Aug 24 17:17 TAIR10_chr_all.fas_17mer.jf *TAIR10_chr_all.fas.bed* is the probe file. .. code-block:: log $ more probes/TAIR10_chr_all.fas.bed 1 52 96 TCCCTAAATCTTTAAATCCTACATCCATGAATCCCTAAATACCTA 1 211 255 TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTC 1 346 390 CCTTAGGGTTGGTTTATCTCAAGAATCTTATTAATTGTTTGGACT 1 426 470 TTTGTGGAAATGTTTGTTCTATCAATTTATCTTTTGTGGGAAAAT 1 496 540 TCTTCGTTGTTGTTACGCTTGTCATCTCATCTCTCAATGATATGG 1 551 595 TAGCATTTATTCTGAAGTTCTTCTGCTTGATGATTTTATCCTTAG There are four columns in a row, first column is chromosome name, second is oligo start site, third is oligo end site, last one is oligo probe sequence. You can use excel or text editor to open this file. Using Manually Install Version ------------------------------ Install ******* * `Manually Install`_ .. _`Manually Install`: \install.html#ubuntu-14-04-terminal Run In Terminal *************** Make a project folder .. code-block:: bash $ cd ~ $ mkdir sampleproject $ cd sampleproject Download Arabidopsis reference genome .. code-block:: bash $ wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_chromosome_files/TAIR10_chr_all.fas Test chorus software .. code-block:: bassh $ python3 /opt/software/Chorus/Chorus.py -h usage: Chorus [-h] [--version] [-j JELLYFISH] [-b BWA] -g GENOME -i INPUT [-s SAVED] [-p PRIMER] [-t THREADS] [-l LENGTH] [--homology HOMOLOGY] [-d DTM] [--step STEP] [--docker DOCKER] Chorus Software for Oligo FISH probe design optional arguments: -h, --help show this help message and exit --version show program's version number and exit -j JELLYFISH, --jellyfish JELLYFISH jellyfish path -b BWA, --bwa BWA bwa path -g GENOME, --genome GENOME fasta format genome file -i INPUT, --input INPUT fasta format input file -s SAVED, --save SAVED result saved folder -p PRIMER, --primer PRIMER 5' labeled R primer -t THREADS, --threads THREADS threads number or how may cpu you wanna use -l LENGTH, --length LENGTH probe length --homology HOMOLOGY homology, from 50 to 100 -d DTM, --dtm DTM dTm, from 0 to 37 --step STEP step length, min=1 --docker DOCKER Run chorus software .. code-block:: bash $ python3 /opt/software/Chorus/Chorus.py -i TAIR10_chr_all.fas \ -g TAIR10_chr_all.fas -t 12 \ -j /opt/software/jellyfish/bin/jellyfish -b /opt/software/bwa/bwa -s sample When job finish, the oligo probes will output to 'sample' folder .. code-block:: bash $ cd sample $ ls -lt * total 1741428 -rw-r--r-- 1 root root 280927981 Aug 24 17:44 TAIR10_chr_all.fas_all.bed -rw-r--r-- 1 root root 62050561 Aug 24 17:44 TAIR10_chr_all.fas.bed -rw-r--r-- 1 root root 94 Aug 24 17:30 TAIR10_chr_all.fas.len -rw-r--r-- 1 root root 1031512169 Aug 24 17:22 TAIR10_chr_all.fas_tmp_probe.fa -rw-r--r-- 1 root root 59833928 Aug 24 17:19 TAIR10_chr_all.fas.sa -rw-r--r-- 1 root root 7535 Aug 24 17:18 TAIR10_chr_all.fas.amb -rw-r--r-- 1 root root 682 Aug 24 17:18 TAIR10_chr_all.fas.ann -rw-r--r-- 1 root root 29916939 Aug 24 17:18 TAIR10_chr_all.fas.pac -rw-r--r-- 1 root root 119667836 Aug 24 17:18 TAIR10_chr_all.fas.bwt -rw-r--r-- 1 root root 121183059 Aug 24 17:17 TAIR10_chr_all.fas -rw-r--r-- 1 root root 78102510 Aug 24 17:17 TAIR10_chr_all.fas_17mer.jf *TAIR10_chr_all.fas.bed* is the probe file. .. code-block:: log $ more probes/TAIR10_chr_all.fas.bed 1 52 96 TCCCTAAATCTTTAAATCCTACATCCATGAATCCCTAAATACCTA 1 211 255 TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTC 1 346 390 CCTTAGGGTTGGTTTATCTCAAGAATCTTATTAATTGTTTGGACT 1 426 470 TTTGTGGAAATGTTTGTTCTATCAATTTATCTTTTGTGGGAAAAT 1 496 540 TCTTCGTTGTTGTTACGCTTGTCATCTCATCTCTCAATGATATGG 1 551 595 TAGCATTTATTCTGAAGTTCTTCTGCTTGATGATTTTATCCTTAG There are four columns in a row, first column is chromosome name, second is oligo start site, third is oligo end site, last one is oligo probe sequence. You can use excel or text editor to open this file.